5SRNAdb: an information resource for 5S ribosomal RNAs

نویسندگان

  • Maciej Szymanski
  • Andrzej Zielezinski
  • Jan Barciszewski
  • Volker A. Erdmann
  • Wojciech M. Karlowski
چکیده

Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Human Y5 RNA specializes a Ro ribonucleoprotein for 5S ribosomal RNA quality control.

Humans express four distinct non-protein-coding Y RNAs (ncRNAs). To investigate Y RNA functional diversification, we exploited an RNA-based affinity purification method to isolate ribonucleoproteins (RNPs) assembled on individual human Y RNAs. Silver staining and mass spectrometry revealed that the Ro and La proteins assemble with all Y RNAs, while additional proteins associate with specific Y ...

متن کامل

Two thraustochytrid 5S ribosomal RNAs.

The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGG...

متن کامل

Unusual structural features of the 5S ribosomal RNA from Streptococcus cremoris.

The nucleotide sequence of the 5S ribosomal RNA of Streptococcus cremoris has been determined. The sequence is 5' (sequence in text) 3'. Comparison of the S. cremoris 5S RNA sequence to an updated prokaryotic generalized 5S RNA structural model shows that this 5S RNA contains some unusual structural features. These features result largely from uncommon base substitutions in helices I, II and IV...

متن کامل

Oocyte and somatic 5S ribosomal RNA and 5S RNA encoding genes in Xenopus tropicalis.

We have investigated the structure of oocyte and somatic 5S ribosomal RNA and of 5S RNA encoding genes in Xenopus tropicalis. The sequences of the two 5S RNA families differ in four positions, but only one of these substitutions, a C to U transition in position 79 within the internal control region of the corresponding 5S RNA encoding genes, is a distinguishing characteristic of all Xenopus som...

متن کامل

Nucleotide sequence and structure of cytoplasmic 5S RNA and 5.8S RNA of Chlamydomonas reinhardii.

Three small RNAs of the cytoplasmic 8OS ribosomes of the green unicellular alga Chlamydomonas reinhardii have been sequenced. They include two species of ribosomal 5S RNA, a major and a minor one of 122 and 121 nucleotides respectively, which differ from each other by 17 bases, and also the ribosomal 5.8S RNA of 156 nucleotides. Novel structural features can be recognized in the 5S RNAs of C. r...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:

دوره 44  شماره 

صفحات  -

تاریخ انتشار 2016